Quick Order

Text Size:AAA

Human CCL1 / TCA3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL1/TCA3 cDNA Clone Product Information
RefSeq ORF Size:291bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 1 with Flag tag.
Gene Synonym:CCL1, P500, SISe, TCA3, I-309, SCYA1
Restriction Site:HindIII + XhoI (5.5kb + 0.32kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCL1/TCA3 Gene Plasmid Map
Human CCL1 / TCA3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.

  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • Size / Price
    Catalog: HG10057-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions