After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-GFPSpark tagHG10049-ACG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10049-ACR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-GFPSpark tagHG10049-ANG$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10049-ANR$325
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Flag tagHG10049-CF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-His tagHG10049-CH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-Myc tagHG10049-CM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, C-HA tagHG10049-CY$295
Human Caspase-7 transcript variant alpha Gene cDNA clone plasmidHG10049-M$95
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, Flag tagHG10049-M-F$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Flag tagHG10049-NF$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-His tagHG10049-NH$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-Myc tagHG10049-NM$295
Human Caspase-7 transcript variant alpha ORF mammalian expression plasmid, N-HA tagHG10049-NY$295
Human Caspase-7 transcript variant alpha natural ORF mammalian expression plasmidHG10049-UT$295
 Learn more about expression Vectors
Product nameProduct name

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Images
    • Human Caspase-7 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items