After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TrkC transcript variant 3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TrkC/NTRK3 cDNA Clone Product Information
NCBI RefSeq:NM_001007156.1
RefSeq ORF Size:1839bp
cDNA Description:Full length Clone DNA of Homo sapiens neurotrophic tyrosine kinase receptor, type 3, transcript variant 3 with Flag tag.
Gene Synonym:NTRK3, TRKC, gp145(trkC)
Restriction Site:KpnI + XhoI (5.5kb + 1.87kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TrkC/NTRK3 Gene Plasmid Map
Human TrkC transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Canine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Rhesus PDGFRB / CD140b Protein (Fc Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Rabbit TrkA / NTRK1 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human IGF1R / CD221 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer ProteinHuman PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a ProteinHuman Tie2 / CD202b Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse Axl Kinase Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human EphB2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (His Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human PDGFRa / CD140a Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human CD140b / PDGFRB Protein (His Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Human FLT-3 / CD135 / FLK-2 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse Axl Kinase Protein (His Tag)Human HER3 / ErbB3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphA4 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human Axl Kinase Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Human Tie1 Protein (His Tag)Human c-KIT / CD117 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human EphB1 / EPHT2 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD136 / MST1R Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Canine c-MET / HGFR Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Human RET Kinase Protein (His Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human MERTK / Mer Protein GST TagRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Rat EphA4 Protein (Fc Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Rat TrkA / NTRK1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Human MERTK / Mer(aa 578-872) ProteinHuman PDGFRB / PDGFR-1 / CD140b ProteinHuman EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Mouse TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rhesus PDGFRB / PDGFR-1 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (Fc Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FLT-3 / CD135 / FLK-2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Rhesus EphB1 / EPHT2 Protein (Fc Tag)Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)

NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.

  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.