Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TrkB/NTRK2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Canine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Rhesus PDGFRB / CD140b Protein (Fc Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Rabbit TrkA / NTRK1 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human IGF1R / CD221 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer ProteinHuman PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a ProteinHuman Tie2 / CD202b Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse Axl Kinase Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human EphB2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (His Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human PDGFRa / CD140a Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human CD140b / PDGFRB Protein (His Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Human FLT-3 / CD135 / FLK-2 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse Axl Kinase Protein (His Tag)Human HER3 / ErbB3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphA4 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human Axl Kinase Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Human Tie1 Protein (His Tag)Human c-KIT / CD117 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human EphB1 / EPHT2 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD136 / MST1R Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Canine c-MET / HGFR Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Human RET Kinase Protein (His Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human MERTK / Mer Protein GST TagRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Rat EphA4 Protein (Fc Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Rat TrkA / NTRK1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Human MERTK / Mer(aa 578-872) ProteinHuman PDGFRB / PDGFR-1 / CD140b ProteinHuman EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Mouse TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rhesus PDGFRB / PDGFR-1 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (Fc Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FLT-3 / CD135 / FLK-2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Rhesus EphB1 / EPHT2 Protein (Fc Tag)Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Images
    • Human TrkB transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items