Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LckcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10043-ACG$345
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10043-ACR$345
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10043-ANG$345
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10043-ANR$345
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10043-CF$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10043-CH$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10043-CM$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10043-CY$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10043-M$195
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10043-M-F$395
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10043-NF$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10043-NH$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10043-NM$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10043-NY$315
Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10043-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Protein kinases are critically involved in signaling pathways that regulate cell growth, differentiation, activation, and survival. Initially identified as a T-cell specific member of the Src family of protein tyrosine kinases, Lck has become the object of intensive investigations which have revealed a key role for this kinase in the central processes controlling T-cell development, activation, proliferation and survival. Lck is expressed specifically in lymphoid cells. It contains one protein kinase domain, one SH2 domain, and one SH3 domain. It is associated with a variety of cell surface receptors and is critical for signal transduction from the T-cell antigen receptor (TCR). Consequently, Lck is targeted by regulatory proteins of T-lymphotropic viruses, especially by the Herpesvirus saimiri (HVS) tyrosine kinase interacting protein (Tip). This oncoprotein physically interacts with Lck in HVS transformed T cells and has an impact on its catalytic activity. Together with the identification of defects in the regulation of Lck expression or activity in T-cell leukemias, suggests that dysregulation of Lck might play a role in neoplastic transformation. However, under certain conditions Lck is also involved in the induction of apoptosis. This chemosensitizing effect of Lck is independent of T-cell receptor signaling and does not require the kinase activity of Lck. The findings demonstrate that Lck might be part of two independent signaling pathways leading to either cell proliferation or apoptosis.

References
  • Majolini MB, et al. (1999) Dysregulation of the protein tyrosine kinase LCK in lymphoproliferative disorders and in other neoplasias. Leuk Lymphoma. 35(3-4): 245-54.
  • Isakov N, et al. (2000) Lck protein tyrosine kinase is a key regulator of T-cell activation and a target for signal intervention by Herpesvirus saimiri and other viral gene products. Eur J Biochem. 267(12): 3413-21.
  • Heyninck K, et al. (2006) A novel link between Lck, Bak expression and chemosensitivity. Oncogene. 25(12): 1693-5.
  • Size / Price
    Images
    • Human Lck Kinase transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"