Quick Order

Human vimentin ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VIM cDNA Clone Product Information
Gene_bank_ref_id:NM_003380.2
RefSeq ORF Size:1401bp
cDNA Description:Full length Clone DNA of Homo sapiens vimentin with Flag tag.
Gene Synonym:Vim
Species:Human
Vector:pCMV/hygro-FLAG
Plasmid:pCMV-VIM-flag
Restriction Site:KpnI + XbaI (5.5kb + 1.43kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human vimentin ORF mammalian expression plasmid, Flag tag on other vectors
Product nameProduct name
Background

Vimentin is a type III intermediate filament (IF) protein found in various non-epithelial cells, especially mesenchymal cells. A vimentin monomer, has a central α-helical domain and carboxyl (tail) domains. Two monomers compose the basic subunit of vimentin assembly. Vimentin is crucial for supporting and anchoring the position of the organelles in the cytosol. Vimentin provided cells with a resilience absent from the microtubule or actin filament networks, when under mechanical stress in vivo. Therefore, in general, it is accepted that vimentin is the cytoskeletal component responsible for maintaining cell integrity. Vimentin is also responsible for stabilizing cytoskeletal interactions. It is found that vimentin control the transport of low-density lipoprotein. It has been used as a sarcoma tumor marker to identify mesenchyme.

References
  • Russell RL, et al. (2001) Uridine phosphorylase association with vimentin. Intracellular distribution and localization. J Biol Chem. 276(16):13302-7.
  • Moinova, et al. (2012) Aberrant Vimentin Methylation is Characteristic of Upper GI Pathologies. Cancer Epidemiology Biomarkers Prev. 21(4):594-600.
  • Leader M, et al. (1987) Vimentin: an evaluation of its role as a tumour marker. Histopathology. 11(1):63-72.
  • Size / Price
    Catalog: HG10028-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"