Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ERK5/BMK1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-GFPSpark tagHG10024-ACG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10024-ACR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-GFPSpark tagHG10024-ANG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10024-ANR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Flag tagHG10024-CF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-His tagHG10024-CH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Myc tagHG10024-CM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-HA tagHG10024-CY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA clone plasmidHG10024-M$295
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, Flag tagHG10024-M-F$545
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Flag tagHG10024-NF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-His tagHG10024-NH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Myc tagHG10024-NM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-HA tagHG10024-NY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 natural ORF mammalian expression plasmidHG10024-UT$315
 Learn more about expression Vectors
Product nameProduct name
  • Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items