Quick Order

Text Size:AAA

Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ERK5/BMK1 cDNA Clone Product Information
RefSeq ORF Size:2451bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 7 (MAPK7), transcript variant 3 with Flag tag.
Gene Synonym:MAPK7, BMK1, ERK4, ERK5, PRKM7
Restriction Site:HindIII + XhoI (5.5kb + 2.48kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, Flag tag on other vectors
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-GFPSpark tagHG10024-ACG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10024-ACR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-GFPSpark tagHG10024-ANG$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10024-ANR$345
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Flag tagHG10024-CF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-His tagHG10024-CH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-Myc tagHG10024-CM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, C-HA tagHG10024-CY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 Gene cDNA clone plasmidHG10024-M$295
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Flag tagHG10024-NF$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-His tagHG10024-NH$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-Myc tagHG10024-NM$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 ORF mammalian expression plasmid, N-HA tagHG10024-NY$315
Human MAPK7 / ERK5 / BMK1 transcript variant 3 natural ORF mammalian expression plasmidHG10024-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10024-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions