After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human interleukin 12A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL12A/P35 cDNA Clone Product Information
NCBI RefSeq:NM_000882.2
RefSeq ORF Size:762bp
cDNA Description:Full length Clone DNA of interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35).
Gene Synonym:IL12A, P35, CLMF, NFSK, NKSF1, IL-12A
Restriction Site:KpnI + XhoI (5.5kb + 0.76kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL12A/P35 Gene Plasmid Map
Human interleukin 12A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12B / P40 Protein (Fc Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12RB1 / IL12RB / CD212 Protein (His Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinRat gp130 / IL6ST / CD130 Protein (His Tag)Mouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL12B / IL-12B Protein (Fc Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Human IL27 / Interleukin-27 Protein (His Tag)Mouse IL27 / Interleukin-27 Protein (His Tag)Mouse IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Rat IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL12B / IL-12B Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Marmoset IL-23 (IL23A & IL12B Heterodimer) ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinRhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12A & IL27B Heterodimer ProteinRhesus IL12A / NKSF1 Protein (Fc Tag)

Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.

  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.