After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KDR/VEGFR2/CD309 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGF-B / VEGFB Protein (Fc Tag)Mouse VEGFA / VEGF164 ProteinHuman VEGF121 / VEGF-A ProteinMouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Mouse PIGF / PLGF Protein (Fc Tag)Rat VEGF164 / VEGFA ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGF121 / VEGF-A ProteinMouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinDanio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinMouse VEGF-D / VEGFD / FIGF Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Mouse PIGF / PLGF ProteinHuman VEGF121b / VEGF-A ProteinCanine VEGF / VEGFA ProteinHuman Neuropilin 2 / NRP2 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

  • Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.
  • Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.
  • Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.
  • Images
    • Human CD309 / VEGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items