Quick Order

Human GCSF transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human G-CSF/CSF3 cDNA Clone Product Information
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 (granulocyte), transcript variant 1.
Gene Synonym:CSF3, GCSF, G-CSF
Restriction Site:KpnI + XhoI (5.5kb + 0.62kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human G-CSF/CSF3 Gene Plasmid Map
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.
  • Size / Price
    Catalog: HG10006-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions