After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GCSF transcript variant 1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human G-CSF/CSF3 cDNA Clone Product Information
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 (granulocyte), transcript variant 1 with Flag tag.
Gene Synonym:CSF3, GCSF, G-CSF
Restriction Site:KpnI + XhoI (5.5kb + 0.65kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.