Quick Order

Cynomolgus monkey BTLA Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BTLAcDNA Clone Product Information
cDNA Size:870
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) b- and T-lymphocyte attenuator-like DNA.
Gene Synonym:BTLA
Restriction Site:KpnI + XhoI
Sequence Description:Identical with AF395616 [ Macaca mulatta (Rhesus monkey) ]: 333 C/G and 642 G/A not causing the amino acid variation. Please check the sequence information before order.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).

  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Cynomolgus monkey BTLA Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged