After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Positive control for the pCMV / hygro-FLAG.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag) Physical Map

 Vector Name pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)


pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag) Sequence and Quality Control


781      TAA
1. Signal peptide
2. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression.
3. FLAG Tag
Detect Positive Control Vector Expression by Western Blot


Protocol :
The 6 µg of plasmid was transfected into 20 ml of HEK293H suspension cells with Sinofection reagent (Cat# STF01). Experssion cells were cultured for 4d at 37°C (5% CO2). The 2×107 of cells were lysed in 1 ml of ice-cold modified RIPA Lysis Buffer with protease inhibitors cocktail (Sigma) by homogenization. The protein concentration of cell lysate was measured by BCA kit, and 1~5 µg of lysate were detected by western blotting using specific anti-tag antibody.
Size / Price
Catalog: CV010
List Price:   (Save )
Price:      [How to order]
Availabilityon SaleShipping instructions