After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Positive control for the pCMV / hygro-Myc.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag) Physical Map

 
Description
 Vector Name pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)
 Vector Size 6338bp
 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag GAGCAGAAACTCATCTCAGAAGAGGATCTG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

 

 
pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag) Sequence and Quality Control

 

1        ATGGGCTGGT CCTGCATCAT CCTGTTCCTC GTGGCGACCG CGACCGGGGT CCACAGC1GAG
61       CCCAAATCTT CTGACAAAAC TCACACATGC CCACCGTGCC CAGCACCTGA ACTCCTGGGG
121      GGACCGTCAG TCTTCCTCTT CCCCCCAAAA CCCAAGGACA CCCTCATGAT CTCCCGGACC
181      CCTGAGGTCA CGTGCGTGGT GGTGGACGTG AGCCACGAAG ACCCCGAGGT CAAGTTCAAC
241      TGGTACGTGG ACGGCGTGGA GGTGCATAAT GCCAAGACAA AGCCGCGGGA GGAGCAGTAC
301      AACAGCACGT ACCGTGTGGT CAGCGTCCTC ACCGTCCTGC ACCAGGACTG GCTGAATGGC
361      AAGGAGTACA AGTGCAAGGT CTCCAACAAA GCCCTCCCAG CCCCCATCGA GAAAACCATC
421      TCCAAAGCCA AAGGGCAGCC CCGAGAACCA CAGGTGTACA CCCTGCCCCC ATCCCGGGAT
481      GAGCTGACCA AGAACCAGGT CAGCCTGACC TGCCTGGTCA AAGGCTTCTA TCCCAGCGAC
541      ATCGCCGTGG AGTGGGAGAG CAATGGGCAG CCGGAGAACA ACTACAAGAC CACGCCTCCC
601      GTGCTGGACT CCGACGGCTC CTTCTTCCTC TACAGCAAGC TCACCGTGGA CAAGAGCAGG
661      TGGCAGCAGG GGAACGTCTT CTCATGCTCC GTGATGCATG AGGCTCTGCA CAACCACTAC
721      ACGCAGAAGA GCCTCTCCCT GTCTCCGGGT AAAGCT2GAGC AGAAACTCAT CTCAGAAGAG
781      GATCTG3TAA
1. Signal peptide
2. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression.
3. Myc Tag
 
Detect Positive Control Vector Expression by Western Blot

 

Protocol :
The 6 µg of plasmid was transfected into 20 ml of HEK293H suspension cells with Sinofection reagent (Cat# STF01). Experssion cells were cultured for 4d at 37°C (5% CO2). The 2×107 of cells were lysed in 1 ml of ice-cold modified RIPA Lysis Buffer with protease inhibitors cocktail (Sigma) by homogenization. The protein concentration of cell lysate was measured by BCA kit, and 1~5 µg of lysate were detected by western blotting using specific anti-tag antibody.
Size / Price
Catalog: CV009
List Price:   (Save )
Price:      [How to order]
Availabilityon SaleShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"