Quick Order

pCMV / hygro-Negative Control Vector (FLAG-tagged)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Negative control for the pCMV / hygro-FLAG clone.
  • sequence is the same as pCMV / hygro-FLAG, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV / hygro-Negative Control Vector (FLAG-tagged) Physical Map
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV / hygro-FLAG
 Vector Size

5552bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag GATTACAAGGATGACGACGATAAG
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

 

 
Schematic of pCMV / hygro-Negative Control Vector (FLAG-tagged) Multiple Cloning Sites

Size / Price
Catalog:CV005
List Price: $120.00  (Save $0.00)
Price:$120.00      [How to order]
Availabilityon Sale
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"