After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

pCMV / hygro-Negative Control Vector (FLAG-tagged)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Negative control for the pCMV / hygro-FLAG clone.
  • sequence is the same as pCMV / hygro-FLAG, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV / hygro-Negative Control Vector (FLAG-tagged) Physical Map
Vector Sequence
 Vector Name pCMV / hygro-FLAG
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)


Schematic of pCMV / hygro-Negative Control Vector (FLAG-tagged) Multiple Cloning Sites

Size / Price
List Price: $120.00  (Save $0.00)
Price:$120.00      [How to order]
Availabilityon Sale
    Recently Viewed Items