Quick Order

Text Size:AAA

pCMV / hygro-Negative Control Vector (untagged)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
  • Negative control for the untagged-pCMV clone.
  • Vector sequence is the same as pCMV / hygro, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV / hygro-Negative Control Vector (untagged) Physical Map
Vector Sequence
Download     
 
Description
 
 Vector Name  pCMV / hygro-Negative Control Vector (untagged)
 Vector Size

 5504bp

 Vector Type  Mammalian Expression Vector
 Expression Method  Constitutive, Stable / Transient
 Promoter  CMV
 Antibiotic Resistance  Ampicillin
 Selection In Mammalian Cells  Hygromycin
 Protein Tag  None
 Sequencing Primer  Forward:T7(TAATACGACTCACTATAGGG)
 Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV / hygro-Negative Control Vector (untagged) Multiple Cloning Sites

Size / Price
Catalog: CV001
List Price:   (Save )
Price:      [How to order]
Availabilityon SaleShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"