Quick Order

Text Size:AAA

Human GNGT1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GNGT1 cDNA Clone Product Information
NCBI RefSeq:BC029367
RefSeq ORF Size:225bp
cDNA Description:Full length Clone DNA of Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 with N terminal HA tag.
Gene Synonym:GNG1, GNGT1
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GNGT1 is a subunit of of transducin. Heterotrimeric G proteins consist of alpha, beta, and gamma subunits. They are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. G proteins are bound to GDP in the 'off' state. GNGT1 is the gamma subunit of transducin. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.

References
  • Tao L, et al. (1993) Structure of the bovine transducin gamma subunit gene and analysis of promoter function in transgenic mice. Exp Eye Res. 56 (4): 497-507.
  • Yan K, et al. (1996) Differential ability to form the G protein betagamma complex among members of the beta and gamma subunit families. J Biol Chem. 271 (12): 7141-6.
  • Gaudet R, et al. (1999) A molecular mechanism for the phosphorylation-dependent regulation of heterotrimeric G proteins by phosducin. Mol Cell. 3 (5): 649-60.
  • Size / Price
    Catalog: HG13658-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"