Quick Order

Text Size:AAA

Human GALE Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GALEcDNA Clone Product Information
cDNA Size:1047
cDNA Description:ORF Clone of Homo sapiens UDP-galactose-4-epimerase DNA.
Gene Synonym:SDR1E1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

UDP galactose-4'-epimerase, also known as GALE, enables the body to process a simple sugar called galactose, which is present in small amounts in many foods. Galactose is primarily part of a larger sugar called lactose, which is found in all dairy products and many baby formulas. UDP galactose-4'-epimerase catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. Defects in GALE causes epimerase-deficiency galactosemia (EDG), also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation.

  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Lee KA. et al., 2011,. J Biol Chem. 286 (48): 41530-8.
  • McCorvie TJ. et al., 2012, Biochim Biophys Acta. 1822 (10): 1516-26.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items