After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AIMP1cDNA Clone Product Information
cDNA Size:939
cDNA Description:ORF Clone of Homo sapiens small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) DNA.
Gene Synonym:p43, AIMP1, EMAP2, EMAP-2, EMAPII, EMAP-II
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10623-ACG$325
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10623-ACR$325
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10623-ANG$325
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10623-ANR$325
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10623-CF$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10623-CH$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10623-CM$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10623-CY$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone)HG10623-M$95
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10623-M-F$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10623-M-N$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10623-NF$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10623-NH$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10623-NM$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10623-NY$295
Human AIMP1 / SCYE1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10623-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Aminoacyl tRNA synthase complex-interacting multifunctional protein 1, also known as Multisynthase complex auxiliary component p43, Endothelial monocyte-activating polypeptide II, AIMP1, EMAP2 and SCYE1, is a nucleus protein which contains one tRNA-binding domain. AIMP1 (also known as p43) is a factor associated with a macromolecular aminoacyl-tRNA synthetase (ARS) complex but also plays diverse regulatory roles in various physiological processes. AIMP1 negatively regulates TGF-beta signaling via stabilization of Smurf2. It suggests the novel activity of AIMP1 as a component of negative feedback loop of TGF-beta signaling. Recently, it been demonstrated that AIMP1 is also secreted and acts as a novel pleiotropic cytokine. AIMP1 protein induces the maturation and activation of DCs, which skew the immune response toward a Th1 response. AIMP1 is known as a cytokine working in the control of angiogenesis, inflammation, and wound healing. AIMP1 is secreted from the pancreas upon glucose starvation, and it also plays a glucagon-like role in glucose homeostasis. Although AIMP1 was identified as a component of the macromolecular aminoacyl tRNA synthetase complex involved in the cellular translation process, it was also found to be secreted as a cytokine having complex physiological functions. Among these, AIMP1's angiostatic and immune stimulating activities suggest its potential use as a novel antitumor therapeutic protein. AIMP1 may exert its antitumor activity by inducing tumor-suppressing cytokines. Thus, AIMP1 may be useful as a novel anti-tumor agent.

  • Lee YS, et al. (2006) Antitumor activity of the novel human cytokine AIMP1 in an in vivo tumor model. Mol Cells. 21(2): 213-7.
  • Park SG, et al. (2006) Hormonal activity of AIMP1/p43 for glucose homeostasis. Proc Natl Acad Sci U S A. 103(40): 14913-8.
  • Kim E, et al. (2008) AIMP1/p43 protein induces the maturation of bone marrow-derived dendritic cells with T helper type 1-polarizing ability. J Immunol. 180(5): 2894-902.
  • Lee YS, et al. (2008) AIMP1/p43 downregulates TGF-beta signaling via stabilization of smurf2. Biochem Biophys Res Commun. 371(3): 395-400.
  • Han JM, et al. (2010) Antitumor activity and pharmacokinetic properties of ARS-interacting multi-functional protein 1 (AIMP1/p43). Cancer Lett. 287(2): 157-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items