After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HTRA2cDNA Clone Product Information
cDNA Size:1377
cDNA Description:ORF Clone of Homo sapiens HtrA serine peptidase 2 DNA.
Gene Synonym:OMI, PARK13, PRSS25
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10619-ACG$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10619-ACR$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10619-ANG$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10619-ANR$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10619-CF$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10619-CH$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10619-CM$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10619-CY$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone)HG10619-M$95
Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10619-M-F$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10619-M-N$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10619-NF$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10619-NH$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10619-NM$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10619-NY$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10619-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items