Quick Order

Human CCL28 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL28cDNA Clone Product Information
cDNA Size:384
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 28 DNA.
Gene Synonym:MEC, CCK1, SCYA28, MGC71902
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Chemokine & Receptor Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
    Recently Viewed Items