After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SRGN ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SRGN cDNA Clone Product Information
Gene_bank_ref_id:BC015516
RefSeq ORF Size:477bp
cDNA Description:Full length Clone DNA of Homo sapiens serglycin with N terminal HA tag.
Gene Synonym:PPG, PRG, PRG1, SRGN
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

SRGN is known as a hematopoietic cell granule proteoglycan. Proteoglycans stored in the secretory granules of various hematopoietic cells has a protease-resistant peptide core, and is vital for neutralizing hydrolytic enzymes. SRGN is associated with the macromolecular complex of granzymes and perforin, which may serve as a mediator of granule-mediated apoptosis. It is required for storage of some proteases in both connective tissue and mucosal mast cells and for storage of granzyme B in T-lymphocytes. SRGN also plays a role in localizing neutrophil elastase in azurophil granules of neutrophils.

References
  • Hatton MN. et al., 1985, Biochem J. 230 (3): 817-20.
  • Schick BP. et al., 1995, J Cell Physiol. 165 (1): 96-106.
  • Kato S. et al., 1995, Gene. 150 (2): 243-50.
  • Size / Price
    Catalog: HG13648-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"