Quick Order

Human CXCL6 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CXCL6cDNA Clone Product Information
cDNA Size:345
cDNA Description:ORF Clone of Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) DNA.
Gene Synonym:GCP2, CKA-3, GCP-2, SCYB6
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Chemokine & Receptor Related Products
Product nameProduct name
Canine XCL1 Protein (His Tag)Human CXCL2 / MIP-2 ProteinRat CXCL1 / MGSA / NAP-3 ProteinRat CXCL2 / MIP-2 ProteinHuman CCL20 / MIP-3 alpha Protein (His Tag)Rat CCL3 / Mip1a ProteinHuman FAM19A4 / TAFA4 Protein (Fc Tag)Human CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL23 / MIP 3 Protein (His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 49-109, His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 40-113, His Tag)Mouse CCL22 / MDC Protein (His Tag)Mouse CXCL14 / BRAK ProteinMouse CXCL1 / MGSA / NAP-3 ProteinHuman NAP-2 / PPBP / CXCL7 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human I-309 / CCL1 / TCA-3 ProteinHuman CCL13 / MCP-4 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human CXCL12 / SDF1b Protein (Fc Tag)Human CXCL12 / SDF-1 ProteinHuman CCL18 / PARC / MIP4 Protein (His Tag)Human CCL22 / MDC Protein (His Tag)Human CCL17 / TARC / SCYA17 Protein (His Tag)Human CCL17 / TARC / SCYA17 ProteinHuman CCL11 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (aa 28-93, His Tag)Human CCL21 / 6Ckine ProteinMouse CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL27 / CTACK Protein (His Tag)Human Fractalkine / CX3CL1 Protein (His Tag)Human XCL1 Protein (His Tag)Human CXCL10 / Crg-2 ProteinHuman CXCL4 / PF4 ProteinHuman CXCL1 / MGSA / NAP-3 Protein (His & NusA Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & SUMO Tag)Human CXCL14 / BRAK ProteinHuman CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CXCL5 ProteinHuman CCL15 / MIP-5 / MIP-1 delta Protein (aa 22-113, His Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 46-113, His Tag)Human CCL5 / RANTES Protein (His & mucin Tag)Human CCL24 / Eotaxin-2 / MPIF-2 Protein (His Tag)Human CCL8 / MCP-2 Protein (SUMO Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL4 / MIP1B Protein (His Tag)Human CCL3 / Mip1a Protein (His Tag)Human CXCL3 / GRO gamma Protein (His Tag)Human FAM19A2 Protein (Fc Tag)Human MCP-3 / CCL7 Protein (His Tag)Human MCP-3 / CCL7 Protein (His Tag)Cynomolgus / Rhesus Fractalkine / CX3CL1 Protein (Fc Tag)Human XCL2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a, His Tag)Human CXCL12 / SDF-1 Protein (isoform a)Human CXCL1 / MGSA / NAP-3 ProteinMouse CXCL12 / SDF-1 ProteinMouse CCL6 / C-C motif ligand 6 Protein (His Tag)Mouse CCL17 / TARC ProteinMouse CCL20 / MIP-3 alpha Protein (His Tag)Mouse CXCL2 / GRO2 / MIP-2 (His & SUMO Tag)Mouse CXCL16 / SR-PSOX Protein (His Tag)Mouse CXCL9 / MIG / C-X-C motif chemokine 9 ProteinMouse I-309 / CCL1 / TCA-3 Protein (Fc Tag)Mouse CCL8 / MCP-2 Protein (His & NusA Tag)Mouse XCL1 Protein (His Tag)Human CCL28 Protein (His Tag)Mouse CCL3 / Mip1a ProteinCanine IL-8 / CXCL8 ProteinCanine CXCL12 / SDF-1 ProteinCanine CXCL13 / BCA-1 Protein (His Tag)Canine CXCL16 / SR-PSOX Protein (His Tag)Rat NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (His Tag)Cynomolgus CXCL12 / SDF-1 Protein (Fc Tag)Cynomolgus CXCL13 / BCA-1 / BLC Protein (His Tag)Cynomolgus CCL17 / TARC Protein (His Tag)Cynomolgus XCL1 Protein (His Tag)Cynomolgus NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Cynomolgus CXCL9 / MIG / C-X-C motif chemokine 9 ProteinCynomolgus CCL21 / 6Ckine ProteinCynomolgus IL-8 / CXCL8 ProteinMouse MCP-3 / CCL7 Protein (His Tag)Human CCL5 / RANTES ProteinHuman CCL23 / MIP 3 Protein (His Tag)Human CCL23 / MIP 3 ProteinCanine CXCL16 / SR-PSOX Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availsability:5 business days