Quick Order

Mouse MEP1A ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MEP1A cDNA Clone Product Information
Gene_bank_ref_id:NM_008585.2
RefSeq ORF Size:2283bp
cDNA Description:Full length Clone DNA of Mus musculus meprin 1 alpha with C terminal His tag.
Gene Synonym:Mep1, Mep-1, Mep-1a, AI098089, AW107200, Mep1a
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I  membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).

References
  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
  • Size / Price
    Catalog: MG50057-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"