Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human XIAP cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

References
  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"