After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human XIAP cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

E3 ubiquitin-protein ligase XIAP / BIRC4, also known as inhibitor of apoptosis protein 3, X-linked inhibitor of apoptosis protein, and IAP-like protein, is a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. XIAP / BIRC4 functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. XIAP / BIRC4 also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this encoding gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Thought to be the most potent apoptosis suppressor, XIAP / BIRC4, directly binds and inhibits caspases -3, -7 and -9. Survivin, which also binds to several caspases, is up-regulated in a many tumour cell types. Defects in XIAP / BIRC4 are the cause of lymphoproliferative syndrome X-linked type 2 (XLP2). XLP is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Symptoms include severe or fatal mononucleosis, acquired hypogammaglobulinemia, pancytopenia and malignant lymphoma.

  • Holcik M, et al. (2000) Functional Characterization of the X-Linked Inhibitor of Apoptosis (XIAP) Internal Ribosome Entry Site Element: Role of La Autoantigen in XIAP Translation. Mol Cell Biol. 20 (13): 4648-57.
  • Winsauer G, et al. (2008) XIAP regulates bi-phasic NF-kappaB induction involving physical interaction and ubiquitination of MEKK2. Cell Signal. 20 (11): 2107-12.
  • Suzuki Y, et al. (2001) X-linked inhibitor of apoptosis protein (XIAP) inhibits caspase-3 and -7 in distinct modes. J Biol Chem. 276 (29): 27058-63.
  • Images
      Recently Viewed Items