After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse GPC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPC3cDNA Clone Product Information
Gene_bank_ref_id:NM_016697.3
cDNA Size:1740
cDNA Description:ORF Clone of Mus musculus glypican 3 DNA.
Gene Synonym:OCI-5, Gpc3
Species:Mouse
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.

References
  • Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.
  • Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.
  • Size / Price
    Catalog:MG50989-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"