Quick Order

Human BMF Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BMFcDNA Clone Product Information
Gene_bank_ref_id:NM_001003940.1
cDNA Size:555
cDNA Description:ORF Clone of Homo sapiens Bcl2 modifying factor DNA.
Gene Synonym:BMF
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

BMF(Bcl2 modifying factor) belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. BMF contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. BMF is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified.

References
  • Hattori A, et al. (2001) Characterization of long cDNA clones from human adult spleen. DNA Res. 7(6):357-66.
  • Day Catherine L, et al. (2004) Localization of dynein light chains 1 and 2 and their pro-apoptotic ligands. Biochem J. 377(Pt 3):597-605.
  • Puthalakath H, et al. (2001) Bmf: a proapoptotic BH3-only protein regulated by interaction with the myosin V actin motor complex, activated by anoikis. Science. 293(5536):1829-32.
  • Size / Price
    Catalog:HG13639-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"