Quick Order

Human LTBR / TNFRSF3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LTBR cDNA Clone Product Information
RefSeq ORF Size:1308bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3).
Restriction Site:HindIII + XbaI (5.5kb + 1.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 516 A/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Human TL1A / TNFSF15 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rabbit NGFR / TNFRSF16 / P75 Protein (ECD, His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Rhesus OX40 / CD134 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (Fc Tag)Mouse TNFSF12 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman XEDAR / EDA2R Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinMouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Rat TNF-alpha / TNFA ProteinFerret TNF-alpha / TNFA ProteinHuman TNFSF10 / TRAIL / APO-2L / CD253 ProteinMouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human OX-40L / TNFSF4 / CD252 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinMouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat EDAR Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rhesus TNFSF10 / TRAIL / APO-2L ProteinRat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat TNFSF15 / TL1A Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (His Tag)Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat TNFSF12 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Rhesus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 ProteinHuman RANKL / OPGL / TNFSF11 / CD254 ProteinRhesus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus / Human TNFSF12 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rhesus CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Mouse CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Mouse Osteoprotegerin / TNFRSF11B Protein (Fc Tag)

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. Tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and tranformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, it can lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for development and organization of the secondary lymphoid organs and chemokine release.

  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • Size / Price
    Catalog: HG10581-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions