Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL36B cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman IL1RL2 / IL-1Rrp2 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL1F5 / IL36RN ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / DER4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL33 / Interleukin-33 / NF-HEV ProteinMouse IL-18R1 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human p38 alpha / MAPK14 Protein (His Tag)Mouse SIGIRR / TIR8 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL-1 beta / IL1B ProteinMouse IL18BP Protein (His Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human JNK2 / MAPK9 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL18R1 / CD218a Protein (His Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1R9 / IL1RAPL2 Protein (His Tag)Rat IL-1 beta / IL1B Protein (pro form, His Tag)Human SIGIRR / TIR8 Protein (His Tag)Rhesus IL-18 / IL-1F4 Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL1R1 / CD121a Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Mouse IL-1 beta / IL1B ProteinRat IL1R1 / CD121a Protein (His & Fc Tag)Human IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Mouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Rat IL-1 beta / IL1B Protein (mature form)Mouse IL1R1 / CD121a Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Feline IL1B / IL-1 beta ProteinCynomolgus IL-1 beta / IL1B ProteinHuman IL36B / IL1F8 ProteinHuman IL1F6 / IL36A ProteinMouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Canine IL-1 beta / IL1B ProteinHuman IL36G / IL1F9 ProteinMouse IL1F8 / IL36b ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinMouse IL1R1 / CD121a Protein (Fc Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinHuman IL36B / IL1F8 Protein (His Tag)Human IL1F6 / IL36A Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL36G / IL1F9 Protein (aa 18-169, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL36G / IL1F9 Protein (aa 18-169)Human IL1F6 / IL36 Protein (aa 6-158)Human p38 alpha / MAPK14 Protein (His Tag)Mouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rhesus IL18RAP Protein (Fc Tag)Rhesus IL18RAP Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Mouse IL18 / IL-18 ProteinHuman pro form of IL18 / Interleukin 18 / IGIF Protein (GST Tag)(Inactive)Human IL1R1 / CD121a ProteinHuman MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Mouse ERK2 / MAPK1 / MAPK2 ProteinHuman IL1R2 / IL1RB / CD121b ProteinMouse IL1RL1 / ST2 Protein (Fc Tag)Human SIGIRR / TIR8 Protein (Fc Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinMouse IL1RL1 / ST2 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Images
      Recently Viewed Items