Quick Order

Mouse WIF1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WIF1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011915.2
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Mus musculus Wnt inhibitory factor 1 with N terminal Myc tag.
Gene Synonym:WIF-1, AW107799, Wif1
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

WIF1, also known as WIF-1 and wnt inhibitory factor 1, is a secreted protein which binds WNT proteins and inhibits their activities. It contains a WNT inhibitory factor (WIF) domain and 5 epidermal growth factor (EGF)-like domains. WNT proteins are extracellular signaling molecules involved in the control of embryonic development. WIF1 may be involved in mesoderm segmentation and can be detected in fish, amphibia and mammals. WIF-1 is a recurrent target in human salivary gland oncogenesis. Downregulation of WIF1 takes part in the development and progression of pleomorphic adenomas. WIF1 also is a tumor suppressor, and has been found to be epigenetically silenced in various cancers, specifically in nonfunctioning pituitary tumors. WIF1 are expected to have molecular function (protein tyrosine kinase activity) and to localize in various compartments (extracellular space, extracellular region).

References
  • Shepelev MV, et al. (2006) WIF1: perspectives of application in oncology. Mol Gen Mikrobiol Virusol. (4): 3-7.
  • Lin YC, et al. (2006) Wnt signaling activation and WIF-1 silencing in nasopharyngeal cancer cell lines. Biochem Biophys Res Commun. 341(2):635-40.
  • Queimado L, et al. (2007) WIF1, an inhibitor of the Wnt pathway, is rearranged in salivary gland tumors. Genes Chromosomes Cancer. 46(3):215-25.
  • Size / Price
    Catalog: MG50984-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"