Quick Order

Text Size:AAA

Mouse PCSK1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PCSK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_013628.2
RefSeq ORF Size:2262bp
cDNA Description:Full length Clone DNA of Mus musculus proprotein convertase subtilisin/kexin type 1 with N terminal Myc tag.
Gene Synonym:PC1, PC3, Nec1, SPC3, Nec-1, Phpp-1, MGC124320, MGC124321, Pcsk1
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is an enzyme which belongs to the peptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.

References
  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.
  • Size / Price
    Catalog: MG50978-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"