After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ADAM9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ADAM9cDNA Clone Product Information
cDNA Size:2538
cDNA Description:ORF Clone of Mus musculus a disintegrin and metallopeptidase domain 9 (meltrin gamma) DNA.
Gene Synonym:MDC9, Mltng, AU020942, mKIAA0021, Adam9
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

ADAM9 (A disintegrin and metallopeptidase domain 9, MDC9, meltrin gamma), is a type 1 transmembrane protein that has been associated with cancer development and metastases. ADAM9 is consistently overexpressed in various human cancers, and plays a role in tumorigenesis in mouse models. ADAM9 cleaves and releases a number of molecules with important roles in tumorigenesis and angiogenesis, such as EGF, FGFR2iiib, Tie-2, Flk-1, EphB4, CD40, VCAM-1, and VE-cadherin, and could represent a potential therapeutic target in tumors where it is highly expressed. ADAM9 belongs to a family of transmembrane, disintegrin-containing metalloproteinases involved in protein ectodomain shedding and cell-cell and cell-matrix interactions. ADAM-9 adhesive domain plays a role in regulating the motility of cells by interaction with beta1 integrins and modulates MMP synthesis.

  • Caltabiano R, et al. (2011) ADAM-9 expression in intestinal-type adenocarcinoma of the sinonasal tract. Appl Immunohistochem Mol Morphol. 19(3): 283-7.
  • Peduto L. (2009) ADAM9 as a potential target molecule in cancer. Curr Pharm Des. 15(20): 2282-7.
  • Zigrino P, et al. (2007) Role of ADAM-9 disintegrin-cysteine-rich domains in human keratinocyte migration. J Biol Chem. 282(42): 30785-93.