Quick Order

Mouse GHR transcript variant 1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GHR cDNA Clone Product Information
NCBI RefSeq:NM_010284.2
RefSeq ORF Size:1953bp
cDNA Description:Full length Clone DNA of Mus musculus growth hormone receptor, transcript variant 1 with C terminal His tag.
Gene Synonym:GHBP, GHR/BP, AA986417, Ghr
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I  membrane protein which belongs to the type I  cytokine receptor family and type 1 subfamily. GHR contains one fibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform 4 of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform 1 expression of GHR in placenta is predominant in chorion and decidua. Isoform 4 is highly expressed in placental villi. Isoform 2 of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform 2 of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.

References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
  • Size / Price
    Catalog: MG50043-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"