Quick Order

Text Size:AAA

Human DDC Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DDCcDNA Clone Product Information
cDNA Size:1443
cDNA Description:ORF Clone of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) DNA.
Gene Synonym:AADC
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 49 G/T resulting in the amino acid 17Val substitution by Met.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human DDC Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Related Products
Product nameProduct name

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.