Quick Order

Text Size:AAA

Human CLEC4M / CD299 / DC-SIGNR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC4M cDNA Clone Product Information
RefSeq ORF Size:1200bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member M.
Gene Synonym:CD299, LSIGN, CD209L, L-SIGN, DCSIGNR, HP10347, DC-SIGN2, DC-SIGNR, MGC47866, MGC129964
Restriction Site:KpnI + XhoI (5.5kb + 1.2kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

C-type lectin domain family 4, member M, also known as DC-SIGNR and CLEC4M, is a type II integral membrane protein that is 77% amino acid identical to DC-SIGN, an HIV gp120-binding protein. Though the encoded gene located in the same chromosome, DC-SIGN is expressed solely on dendritic cells, while DC-SIGNR is predominantly found in liver sinusoidal endothelial cells and lymph node, as well as placental endothelium. DC-SIGNR exists as a homotetramer, and the tandem repeat domain, also called neck domain, mediates oligermerization. DC-SIGNR is ragarded as a pathogen-recognition receptor involved in peripheral immune surveillance in liver, and probably mediate the endocytosis of pathogens which are subsequently degraded in lysosomal compartments. DC-SIGNR appears to selectively recognize and bind many viral surface glycoproteins containing high mannose N-linked oligosaccharides in a calcium-dependent manner, including HIV-1 gp120, HIV-2 gp120, SIV gp120, ebolavirus glycoproteins, HCV E2, and human SARS coronavirus protein S, as well as the cellular adhesion protein ICAM3. DC-SIGNR have been thought to play an important role in establishing HIV infection by enhancing trans-infection of CD4(+)T cells in the regional lymph nodes. It may affect susceptibility to HIV infection by a mechanism that is different in females and males. DC-SIGNR can bind to hepatitis C virus (HCV), and its polymorphism might affect HCV loads supporting the concept that DC-SIGNR contributes to HCV replication efficacy.

  • Nattermann J, et al. (2006) The tandem-repeat polymorphism of the DC-SIGNR gene in HCV infection. J Viral Hepat. 13(1): 42-6.
  • Wichukchinda N, et al. (2007) The polymorphisms in DC-SIGNR affect susceptibility to HIV type 1 infection. AIDS Res Hum Retroviruses. 23(5): 686-92.
  • Size / Price
    Catalog: HG10559-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions