After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CGR2 / CD32 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FCGR2cDNA Clone Product Information
Gene_bank_ref_id:NM_001077189.1
cDNA Size:1023
cDNA Description:ORF Clone of Mus musculus Fc receptor, IgG, low affinity IIb DNA.
Gene Synonym:CD32, Fcgr2, Fcr-2, Fcr-3, Ly-17, LyM-1, Lym-1, FcgRII, Fcgr2a, Ly-m20, AI528646, Fc[g]RII, F630109E10Rik
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Receptors for Fc portion of IgG (Fcγ Rs) are members of the Ig superfamily, and are divided into three classes designated Fcγ RI (CD64), Fcγ RII (CD32), and Fcγ RIII (CD16). CD32 protein is a low affinity receptor for IgG that binds only IgG immune complexes and is expressed on a diverse range of cells such as monocytes, macrophages, neutrophils, eosinophils, platelets, and B cells. Human CD32 class is encoded by three closely related genes, and designated Fcγ RII A, B, and C which share 94-99% amino acid identity in their extracellular domains but differ substantially in their transmembrane and cytoplasmic domains. CD32 is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators, and regulation of antibody production.

References
  • Williams TE, et al. (2000) Concurrent and independent binding of Fcgamma receptors IIa and IIIb to surface-bound IgG. Biophys J. 79(4): 1867-75.
  • Kanters D, et al. (2007) Expression of activated Fc gamma RII discriminates between multiple granulocyte-priming phenotypes in peripheral blood of allergic asthmatic subjects. J Allergy Clin Immunol. 120(5): 1073-81.
  • Veri MC, et al. (2007) Monoclonal antibodies capable of discriminating the human inhibitory Fcgamma-receptor IIB (CD32B) from the activating Fcgamma-receptor IIA (CD32A): biochemical, biological and functional characterization. Immunology. 121(3): 392-404.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"