Quick Order

Text Size:AAA

Mouse PLS3 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PLS3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001166453.1
RefSeq ORF Size:1893bp
cDNA Description:Full length Clone DNA of Mus musculus plastin 3 (T-isoform) with N terminal Flag tag.
Gene Synonym:AI115446, AL024105, T-fimbrin
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

References
  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • Size / Price
    Catalog: MG52182-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"