Quick Order

Human IDO2 ORF mammalian expression plasmid (Codon Optimized), N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human IDO2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1224bp
cDNA Description:Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 2 with N terminal HA tag.
Gene Synonym:INDOL1, IDO2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

IDO2 belongs to the indoleamine 2,3-dioxygenase family. Indoleamine 2,3-dioxgyenase (IDO), is a cytosolic haem protein which, together with the hepatic enzyme tryptophan 2,3-dioxygenase, catalyzes the conversion of tryptophan and other indole derivatives to kynurenines. In addition to classic IDO (IDO1), a new variant, IDO2, has recently been described. IDO2 is expressed in liver, small intestine, spleen, placenta, thymus, lung, brain, kidney, and colon. IDO is widely distributed in human tissues, its physiological role is not fully understood but is of great interest. IDO can be up-regulated via cytokines such as interferon-gamma, and can thereby modulate the levels of tryptophan, which is vital for cell growth. In humans and mice, the IDO1 and IDO2 genes are present tandemly in a tail-to-head arrangment on chromosome 8. In lower vertebrates such as zebrafish and toads only a single IDO gene may be present that may be more IDO2-like in structure. This closer relationship to IDO2 suggests that IDO2 may actually be the ancestor of the better characterized IDO1 gene, and that IDO1 might have been generated by gene duplication of IDO2 before the origin of tetrapods in mammalian evolutionary history. IDO2 catalyzes the first and rate-limiting step in the kynurenine pathway of tryptophan catabolism.

References
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • Sorensen RB, et al. (2011) Spontaneous cytotoxic T-Cell reactivity against indoleamine 2,3-dioxygenase-2. Cancer Res. 71 (6): 2038-44.
  • Witkiewicz AK, et al. (2009) Genotyping and expression analysis of IDO2 in human pancreatic cancer: a novel, active target. J Am Coll Surg. 208 (5): 781-7.
  • Size / Price
    Catalog: HG13614-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"