Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TFPI2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Tissue factor pathway inhibitor-2 (TFPI2), a member of the Kunitz-type serine proteinase inhibitor family, is a structural homologue of tissue factor pathway inhibitor (TFPI). It is a 32 kDa matrix-associated glycoprotein consisting of a short amino-terminal region, three tandem Kunitz-type domains and a positively charged carboxy-terminal tail. TFPI2 inhibits plasmin-dependent activation of several metalloproteinases. TFPI2 is highly abundant in the full-term placenta and widely expressed in various adult human tissues, such as the liver, skeletal muscle, heart, kidney, and pancreas. The expression of TFPI2 in tumors is inversely related to an increasing degree of malignancy, which may suggest a role for TFPI2 in the maintenance of tumor stability and inhibition of the growth of neoplasms. TFPI2 inhibits the tissue factor/factor VIIa (TF/VIIa) complex and a wide variety of serine proteinases including plasmin, plasma kallikrein, factor XIa, trypsin, and chymotrypsin. TFPI2 is involved in regulating pericellular proteases implicated in a variety of physiologic and pathologic processes including cancer cell invasion, vascular inflammation, and atherosclerosis. TFPI2 has also been shown to induce apoptosis and inhibit angiogenesis, which may contribute significantly to tumor growth inhibition.

  • Peerschke EI, et al. (2004) Tissue factor pathway inhibitor-2 (TFPI-2) recognizes the complement and kininogen binding protein gC1qR/p33 (gC1qR): implications for vascular inflammation. Thromb Haemost. 92(4): 811-9.
  • Rollin J, et al. (2005) Expression and methylation status of tissue factor pathway inhibitor-2 gene in non-small-cell lung cancer. Br J Cancer. 92(4): 775-83.
  • Chand HS, et al. (2005) Structure, function and biology of tissue factor pathway inhibitor-2. Thromb Haemost. 94(6): 1122-30.
  • Sierko E, et al. (2007) The role of tissue factor pathway inhibitor-2 in cancer biology. Semin Thromb Hemost. 33(7): 653-9.
  • Images
      Recently Viewed Items