After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MANF ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MANF cDNA Clone Product Information
Gene_bank_ref_id:NM_029103.3
RefSeq ORF Size:540bp
cDNA Description:Full length Clone DNA of Mus musculus mesencephalic astrocyte-derived neurotrophic factor with N terminal Myc tag.
Gene Synonym:Armet, D17914, AA407711, AA408789, AA673178, D18Mgi17, 3230402M22Rik, Manf
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.

References
  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • Size / Price
    Catalog: MG50954-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"