After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRKCI Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKCIcDNA Clone Product Information
Gene_bank_ref_id:NM_002740.5
cDNA Size:1791
cDNA Description:ORF Clone of Homo sapiens protein kinase C, iota DNA.
Gene Synonym:PKCI, DXS1179E, MGC26534, nPKC-iota, PRKCI
Species:Human
Vector:pCMV/hygro
Restriction Site:BamHI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.

References
  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • Size / Price
    Catalog:HG10534-M-N
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"