Quick Order

Mouse GREM1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GREM1cDNA Clone Product Information
cDNA Size:555
cDNA Description:ORF Clone of Mus musculus gremlin 1 DNA.
Gene Synonym:ld, Drm, Cktsf1b1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

GREM1 belongs to the DAN family. It contains 1 CTCK (C-terminal cystine knot-like) domain. GREM1 is a cysteine knot-secreted protein and acts as an inhibitor in the TGF beta signaling pathway. It inhibits BMP-2, -4, and -7. Inhibition by grem 1 of BMPs in mice allow the expression of fibroblast growth factors (FGFs) 4 and 8 and Sonic hedgehog (SHH) which are necessary for proper limb development. It interacts with SLIT1 and SLIT2 in a glycosylation-dependent manner. As a cytokine, GREM1 may play an important role during carcinogenesis and metanephric kidney organogenesis, as a BMP antagonist required for early limb outgrowth and patterning in maintaining the FGF4-SHH feedback loop. It down-regulates the BMP4 signaling in a dose-dependent manner. It also acts as inhibitor of monocyte chemotaxis. GREM1 is highly expressed in small intestine, fetal brain and colon.

  • Dimitrov BI, et al. (2010) Genomic rearrangements of the GREM1-FMN1 locus cause oligosyndactyly, radio-ulnar synostosis, hearing loss, renal defects syndrome and Cenani--Lenz-like non-syndromic oligosyndactyly. J Med Genet. 47(8):569-74.
  • Heron M, et al. (2011) Genetic variation in GREM1 is a risk factor for fibrosis in pulmonary sarcoidosis. Tissue Antigens. 77(2):112-7.
  • van Vlodrop IJ, et al. (2010) Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am J Pathol. 176(2):575-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items