After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse ASAH2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ASAH2cDNA Clone Product Information
cDNA Size:2271
cDNA Description:ORF Clone of Mus musculus N-acylsphingosine amidohydrolase 2 DNA.
Gene Synonym:AI585898
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

ASAH2 (N-acylsphingosine amidohydrolase 2), also known as neutral ceramidase, is a type II integral membrane protein that can be cleaved to produce a soluble secreted protein. The enzyme is abundant in the brush border membranes of the intestine, and also expressed in several tissues such as kidney, brain and liver. The primary structure of ASAH2/neutral ceramidase is highly conserved from bacteria to humans, however, there is a clear difference in the molecular architecture. The murine ASAH2 possesses ‘amucin box’, a Ser/Thr/Pro-rich domain glycosylated with O-glycans which is necessary to retain the enzyme on the plasma membrane as a type II integral protein. The major physiological function of ASAH2/neutral ceramidase is the metabolism of dietary sphingolipids, and thus plays a role in the generation of messenger molecules such as sphingosine and sphingosine 1-phosphate.

  • Tani M, et al. (2000) Molecular cloning of the full-length cDNA encoding mouse neutral ceramidase. A novel but highly conserved gene family of neutral/alkaline ceramidases. J Biol Chem. 275(15): 11229-34.
  • Franzen R, et al. (2002) Nitric oxide induces neutral ceramidase degradation by the ubiquitin/proteasome complex in renal mesangial cell cultures. FEBS Lett. 532(3): 441-4.
  • Kono M, et al. (2006) Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J Biol Chem. 281(11): 7324-31.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items