Quick Order

Mouse PRMT5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRMT5cDNA Clone Product Information
cDNA Size:1914
cDNA Description:ORF Clone of Mus musculus protein arginine N-methyltransferase 5 DNA.
Gene Synonym:Jbp1, Skb1, Prmt5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items