Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CTSS cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

References
  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"