After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SMYD3 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse SMYD3 cDNA Clone Product Information
NCBI RefSeq:NM_027188.3
RefSeq ORF Size:1287bp
cDNA Description:Full length Clone DNA of Mus musculus SET and MYND domain containing 3 with N terminal Myc tag.
Gene Synonym:Zmynd1, 2410008A19Rik, Smyd3
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SET and MYND domain-containing protein 3, also known as Zinc finger MYND domain-containing protein 1, SMYD3, and ZMYND, is a member of the histone-lysine methyltransferase family. SMYD3 contains one MYND-type zinc finger and one SET domain. SMYD3 is a histone H3 lysine-4-specific methyltransferase. It is expressed in skeletal muscles and testis. It is overexpressed in a majority of colorectal carcinoma (CRC) and hepatocellular carcinoma (HCC). SMYD3 plays an important role in transcriptional regulation in human carcinogenesis. It activates the transcription of a set of downstream genes. Of these downstream genes, there are several oncogenes and genes associated with cell adhesion (including those of N-Myc, CrkL, Wnt10b, L-selectin, CD31 and galectin-4), which have been shown to have effects on cell viability, adhesion, migration and metastasis. Increased SMYD3 expression is essential for the proliferation of breast cancer cells. SMYD3 may be a promising new target of therapeutic intervention for the treatment of cancers or other pathological processes associated with cell adhesion and migration.

References
  • Hamamoto, R. et al., 2006, Cancer Sci. 97 (2): 113-8.
  • Luo, XG. et al., 2007, J Biosci Bioeng. 103 (5): 444-50.
  • Wang, XQ. et al., 2007, Exp Oncol. 29 (1): 71-3.
  • Silva, FP. et al., 2008, Oncogene. 27 (19): 2686-92.
  • Size / Price
    Catalog: MG50930-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"