Quick Order

Human NKp30 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCR3cDNA Clone Product Information
Gene_bank_ref_id:NM_147130.1
cDNA Size:606
cDNA Description:ORF Clone of Homo sapiens natural cytotoxicity triggering receptor 3 DNA.
Gene Synonym:1C7, MALS, CD337, LY117, NKp30, NCR3
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Natural Cytotoxicity Triggering Receptor 3, NCR3, also known as NKp30, or CD337, is a natural cytotoxicity receptor, expressed on subsets of human peripheral blood NK cells, involved in NK cell killing of tumor cells and immature dendritic cells. The cellular ligand for NKp30 has remained elusive, but the membrane-associated heparan sulfate (HS) proteoglycans are involved in the recognition of cellular targets by NKp30 was recently reported. NKp30 is a member of the immunoglobulin superfamily and one of three existing natural cytotoxicity-triggering receptors. NKp30 is a glycosylated protein and is thought to be selectively expressed in resting and activated natural killer cells. NKp30 is a stimulatory receptor on human NK cells implicated in tumor immunity, and is capable of promoting or terminating dendritic cell maturation. NCR3 may play a role in inflammatory and infectious diseases.

References
  • Warren HS, et al. (2005) Evidence that the cellular ligand for the human NK cell activation receptor NKp30 is not a heparan sulfate glycosaminoglycan. J Immunol. 175(1): 207-12.
  • Mulcahy H, et al. (2006) LST1 and NCR3 expression in autoimmune inflammation and in response to IFN-gamma, LPS and microbial infection. Immunogenetics. 57(12): 893-903.
  • Hsieh CL, et al. (2006) NKp30 is a functional activation receptor on a subset of rat natural killer cells. Eur J Immunol. 36(8): 2170-80.
  • Ponnampalam AP, et al. (2008) Identification and hormonal regulation of a novel form of NKp30 in human endometrial epithelium. Eur J Immunol. 38(1): 216-26.
  • Size / Price
    Catalog:HG10480-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"