Quick Order

Text Size:AAA

Mouse CHI3L1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CHI3L1 cDNA Clone Product Information
NCBI RefSeq:NM_007695.3
RefSeq ORF Size:1170bp
cDNA Description:Full length Clone DNA of Mus musculus chitinase 3-like 1 with N terminal Myc tag.
Gene Synonym:Gp39, Brp39, AW208766, Chi3l1
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.

References
  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • Size / Price
    Catalog: MG50929-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"