Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL11 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

CCL11 or chemokine (C-C motif) ligand 11 is a member of the chemokine (C-C motif) ligand family. Chemokin (C-C motif) ligand 11 is a member of the chemokine family. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. They share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. CCL11 is implicated in allergic responses through selectively recruiting eosinophils by inducing their chemotaxis. The effects of CCL11 are mediated by its binding to chemokine receptor. Increased CCL11 levels in blood plasma are associated with aging in mice.

  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Coc-chi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Villeda SA, et al. (2011) The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature. 477: 90-4.
  • Images
      Recently Viewed Items